Review



endothelial cell growth media microvascular 2 ecgm mv2  (PromoCell)


Bioz Verified Symbol PromoCell is a verified supplier
Bioz Manufacturer Symbol PromoCell manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    PromoCell endothelial cell growth media microvascular 2 ecgm mv2
    Endothelial Cell Growth Media Microvascular 2 Ecgm Mv2, supplied by PromoCell, used in various techniques. Bioz Stars score: 96/100, based on 123 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ecgm+2+medium/Endothelial+Cell+Growth+Medium+MV+2+Kit/pmc13135260-48-17-23
    Average 96 stars, based on 123 article reviews
    endothelial cell growth media microvascular 2 ecgm mv2 - by Bioz Stars, 2026-10
    96/100 stars

    Images

    Related Articles

    Purification:

    Article Title: Congenital deficiency reveals critical role of ISG15 in skin homeostasis
    Article Snippet: From day 3 to day 7, cultures were maintained in StemPro-34 medium (Thermo Fischer Scientific) supplemented with 260 ng/mL rhVEGF-A165 and 2 μM forskolin (Sigma-Aldrich) with daily medium change. .. On day 7 of differentiation, CD31-positive cells were purified by Magnetic Activated Cell Sorting using CD31 MicroBead Kit (Miltenyi Biotec). hiPSC-ECs were then cultured in ECGM-2 medium (PromoCell) on plates coated with fibronectin (Corning). .. The human keratinocyte cell line HaCaT was cultured in RPMI 1640 medium (GIBCO Life Technologies) supplemented with 30% FCS, 100 μg/mL penicillin-streptomycin, 500 μg/mL gentamycin, and 1% each Glutamax and nonessential amino acid solution (NEAA; GIBCO Life Technologies).

    Article Title: ISG15 deficiency features a complex cellular phenotype that responds to treatment with itaconate and derivatives
    Article Snippet: From day 3 to 7, cultures were maintained in StemPro‐34 medium (Thermo Fischer Scientific, Massachusetts, USA) supplemented with 260 ng/ml rhVEGF‐A165 and 2 μM Forskolin (Sigma‐Aldrich, St. Louis, USA) with daily medium change. .. CD31+ cells were purified by MACS using CD31 MicroBead Kit (Miltenyi). hiPSC‐ECs were cultured on fibronectin (Corning, New York, USA) coated plates in ECGM‐2 medium (PromoCell, Darmstadt, Germany). hTert‐immortalized dermal fibroblasts from a healthy control and an ISG15‐deficient patient, as well as ISG15 –/– fibroblasts transduced with WT or ΔGG ISG15 were kindly provided by Dusan Bogunovic. .. In HaCaT cells the ISG15 locus was ablated with the CRISPR/Cas9 system using two guide RNAs (gRNA) cloned separately into vector PX458_pSpCas9‐2A‐GFP (Addgene, Watertown, MA); gRNA1: GCGCAGATCACCCAGAAGAT; gRNA2: GGTAAGGCAGATGTCACAGG.

    Article Title: Congenital deficiency reveals critical role of ISG15 in skin homeostasis
    Article Snippet: From day 3 to day 7, cultures were maintained in StemPro-34 medium (Thermo Fischer Scientific) supplemented with 260 ng/mL rhVEGF-A165 and 2 μM forskolin (Sigma-Aldrich) with daily medium change. .. On day 7 of differentiation, CD31-positive cells were purified by Magnetic Activated Cell Sorting using CD31 MicroBead Kit (Miltenyi Biotec). hiPSC-ECs were then cultured in ECGM-2 medium (PromoCell) on plates coated with fibronectin (Corning). .. The human keratinocyte cell line HaCaT was cultured in RPMI 1640 medium (GIBCO Life Technologies) supplemented with 30% FCS, 100 μg/mL penicillin-streptomycin, 500 μg/mL gentamycin, and 1% each Glutamax and nonessential amino acid solution (NEAA; GIBCO Life Technologies).

    FACS:

    Article Title: Congenital deficiency reveals critical role of ISG15 in skin homeostasis
    Article Snippet: From day 3 to day 7, cultures were maintained in StemPro-34 medium (Thermo Fischer Scientific) supplemented with 260 ng/mL rhVEGF-A165 and 2 μM forskolin (Sigma-Aldrich) with daily medium change. .. On day 7 of differentiation, CD31-positive cells were purified by Magnetic Activated Cell Sorting using CD31 MicroBead Kit (Miltenyi Biotec). hiPSC-ECs were then cultured in ECGM-2 medium (PromoCell) on plates coated with fibronectin (Corning). .. The human keratinocyte cell line HaCaT was cultured in RPMI 1640 medium (GIBCO Life Technologies) supplemented with 30% FCS, 100 μg/mL penicillin-streptomycin, 500 μg/mL gentamycin, and 1% each Glutamax and nonessential amino acid solution (NEAA; GIBCO Life Technologies).

    Article Title: Congenital deficiency reveals critical role of ISG15 in skin homeostasis
    Article Snippet: From day 3 to day 7, cultures were maintained in StemPro-34 medium (Thermo Fischer Scientific) supplemented with 260 ng/mL rhVEGF-A165 and 2 μM forskolin (Sigma-Aldrich) with daily medium change. .. On day 7 of differentiation, CD31-positive cells were purified by Magnetic Activated Cell Sorting using CD31 MicroBead Kit (Miltenyi Biotec). hiPSC-ECs were then cultured in ECGM-2 medium (PromoCell) on plates coated with fibronectin (Corning). .. The human keratinocyte cell line HaCaT was cultured in RPMI 1640 medium (GIBCO Life Technologies) supplemented with 30% FCS, 100 μg/mL penicillin-streptomycin, 500 μg/mL gentamycin, and 1% each Glutamax and nonessential amino acid solution (NEAA; GIBCO Life Technologies).

    Cell Culture:

    Article Title: Congenital deficiency reveals critical role of ISG15 in skin homeostasis
    Article Snippet: From day 3 to day 7, cultures were maintained in StemPro-34 medium (Thermo Fischer Scientific) supplemented with 260 ng/mL rhVEGF-A165 and 2 μM forskolin (Sigma-Aldrich) with daily medium change. .. On day 7 of differentiation, CD31-positive cells were purified by Magnetic Activated Cell Sorting using CD31 MicroBead Kit (Miltenyi Biotec). hiPSC-ECs were then cultured in ECGM-2 medium (PromoCell) on plates coated with fibronectin (Corning). .. The human keratinocyte cell line HaCaT was cultured in RPMI 1640 medium (GIBCO Life Technologies) supplemented with 30% FCS, 100 μg/mL penicillin-streptomycin, 500 μg/mL gentamycin, and 1% each Glutamax and nonessential amino acid solution (NEAA; GIBCO Life Technologies).

    Article Title: Cytokine Hemoadsorption versus Standard Care in Cardiac Surgery Using the Oxiris Membrane: The OXICARD Single-center Randomized Trial
    Article Snippet: Human umbilical vein endothelial cells were obtained from Promocell (Germany; pooled donors, C12203). .. As recommended by the manufacturer, human umbilical vein endothelial cells were grown in ECGM-2 medium containing 2.5% supplement mix (which corresponds to all media supplements; Promocell, C22011), named “complete ECGM-2 medium,” under standard cell culture conditions (humidified atmosphere, 5% CO 2 , 37°C). ..

    Article Title: 3D modelling of pulmonary arterial stenosis and endothelial dysfunction in CTEPH.
    Article Snippet: Full ECGM-2 supplemented with 10% HyClone FBS and 1% penicillin– streptomycin was used until colony formation. .. PEA cells were then passaged and cultured in 0.2% gelatin (Sigma; cat.: G1890)-coated 75 cm2 tissue culture flasks (Sarstedt; cat.: C-22011), in full ECGM-2 medium (PromoCell, Germany; cat.: C-2211) with antibiotics until 80% confluency. ..

    Article Title: NRF2 activators inhibit influenza A virus replication by interfering with nucleo-cytoplasmic export of viral RNPs in an NRF2-independent manner
    Article Snippet: .. Wild-type and NRF2 -/- iPSC were differentiated into vascular ECs using an established protocol, with positive selection of CD31+ cells as final step [ ]. hiPSC-ECs were cultured on fibronectin (Corning, New York, USA) coated plates in ECGM-2 medium (PromoCell, Darmstadt, Germany). .. For XPO1 knock-down, cells were grown to 90% confluency and transfected with specific (ON-TARGETplus Human XPO1 (7514) siRNA - SMARTpool, 5 nmol, L-003030-00-0005, Horizon Discovery) or control siRNA (ON-TARGETplus Non-targeting Control Pool, D-001810-10-05, Horizon Discovery) using Opti-MEM medium (31985070, Gibco).

    Article Title: Anti-PD-1/anti-VEGF natural antibody structure like heterodimeric form bispecific antibody and preparation thereof
    Article Snippet: Human umbilical vein endothelial cells (HUVEC) were obtained from PromoCell (Catalog No: C-12203). .. HUVEC cells were cultured in a cell incubator with ECGM-2 medium (PromoCell, Catalog No. C-22011), 37° C., 5% CO2. .. The analysis medium was ECBM-2 (PromoCell, Catalog No: C-22211) medium containing 0.4% FBS (Hyclone, Catalog No: SH30084.03).

    Article Title: ISG15 deficiency features a complex cellular phenotype that responds to treatment with itaconate and derivatives
    Article Snippet: From day 3 to 7, cultures were maintained in StemPro‐34 medium (Thermo Fischer Scientific, Massachusetts, USA) supplemented with 260 ng/ml rhVEGF‐A165 and 2 μM Forskolin (Sigma‐Aldrich, St. Louis, USA) with daily medium change. .. CD31+ cells were purified by MACS using CD31 MicroBead Kit (Miltenyi). hiPSC‐ECs were cultured on fibronectin (Corning, New York, USA) coated plates in ECGM‐2 medium (PromoCell, Darmstadt, Germany). hTert‐immortalized dermal fibroblasts from a healthy control and an ISG15‐deficient patient, as well as ISG15 –/– fibroblasts transduced with WT or ΔGG ISG15 were kindly provided by Dusan Bogunovic. .. In HaCaT cells the ISG15 locus was ablated with the CRISPR/Cas9 system using two guide RNAs (gRNA) cloned separately into vector PX458_pSpCas9‐2A‐GFP (Addgene, Watertown, MA); gRNA1: GCGCAGATCACCCAGAAGAT; gRNA2: GGTAAGGCAGATGTCACAGG.

    Article Title: Congenital deficiency reveals critical role of ISG15 in skin homeostasis
    Article Snippet: From day 3 to day 7, cultures were maintained in StemPro-34 medium (Thermo Fischer Scientific) supplemented with 260 ng/mL rhVEGF-A165 and 2 μM forskolin (Sigma-Aldrich) with daily medium change. .. On day 7 of differentiation, CD31-positive cells were purified by Magnetic Activated Cell Sorting using CD31 MicroBead Kit (Miltenyi Biotec). hiPSC-ECs were then cultured in ECGM-2 medium (PromoCell) on plates coated with fibronectin (Corning). .. The human keratinocyte cell line HaCaT was cultured in RPMI 1640 medium (GIBCO Life Technologies) supplemented with 30% FCS, 100 μg/mL penicillin-streptomycin, 500 μg/mL gentamycin, and 1% each Glutamax and nonessential amino acid solution (NEAA; GIBCO Life Technologies).

    Article Title: Anesthesiology
    Article Snippet: Surgical antibiotic prophylaxis is an important measure to prevent postoperative surgical site infections.. Current guideline recommendations do not treat obesity specifically, although it can affect pharmacokinetics and pharmacodynamics.. The objective of this review was to synthesize current evidence on the need for obesity-related dosing adjustments in surgical antibiotic prophylaxis.

    Selection:

    Article Title: NRF2 activators inhibit influenza A virus replication by interfering with nucleo-cytoplasmic export of viral RNPs in an NRF2-independent manner
    Article Snippet: .. Wild-type and NRF2 -/- iPSC were differentiated into vascular ECs using an established protocol, with positive selection of CD31+ cells as final step [ ]. hiPSC-ECs were cultured on fibronectin (Corning, New York, USA) coated plates in ECGM-2 medium (PromoCell, Darmstadt, Germany). .. For XPO1 knock-down, cells were grown to 90% confluency and transfected with specific (ON-TARGETplus Human XPO1 (7514) siRNA - SMARTpool, 5 nmol, L-003030-00-0005, Horizon Discovery) or control siRNA (ON-TARGETplus Non-targeting Control Pool, D-001810-10-05, Horizon Discovery) using Opti-MEM medium (31985070, Gibco).

    Magnetic Cell Separation:

    Article Title: ISG15 deficiency features a complex cellular phenotype that responds to treatment with itaconate and derivatives
    Article Snippet: From day 3 to 7, cultures were maintained in StemPro‐34 medium (Thermo Fischer Scientific, Massachusetts, USA) supplemented with 260 ng/ml rhVEGF‐A165 and 2 μM Forskolin (Sigma‐Aldrich, St. Louis, USA) with daily medium change. .. CD31+ cells were purified by MACS using CD31 MicroBead Kit (Miltenyi). hiPSC‐ECs were cultured on fibronectin (Corning, New York, USA) coated plates in ECGM‐2 medium (PromoCell, Darmstadt, Germany). hTert‐immortalized dermal fibroblasts from a healthy control and an ISG15‐deficient patient, as well as ISG15 –/– fibroblasts transduced with WT or ΔGG ISG15 were kindly provided by Dusan Bogunovic. .. In HaCaT cells the ISG15 locus was ablated with the CRISPR/Cas9 system using two guide RNAs (gRNA) cloned separately into vector PX458_pSpCas9‐2A‐GFP (Addgene, Watertown, MA); gRNA1: GCGCAGATCACCCAGAAGAT; gRNA2: GGTAAGGCAGATGTCACAGG.

    Control:

    Article Title: ISG15 deficiency features a complex cellular phenotype that responds to treatment with itaconate and derivatives
    Article Snippet: From day 3 to 7, cultures were maintained in StemPro‐34 medium (Thermo Fischer Scientific, Massachusetts, USA) supplemented with 260 ng/ml rhVEGF‐A165 and 2 μM Forskolin (Sigma‐Aldrich, St. Louis, USA) with daily medium change. .. CD31+ cells were purified by MACS using CD31 MicroBead Kit (Miltenyi). hiPSC‐ECs were cultured on fibronectin (Corning, New York, USA) coated plates in ECGM‐2 medium (PromoCell, Darmstadt, Germany). hTert‐immortalized dermal fibroblasts from a healthy control and an ISG15‐deficient patient, as well as ISG15 –/– fibroblasts transduced with WT or ΔGG ISG15 were kindly provided by Dusan Bogunovic. .. In HaCaT cells the ISG15 locus was ablated with the CRISPR/Cas9 system using two guide RNAs (gRNA) cloned separately into vector PX458_pSpCas9‐2A‐GFP (Addgene, Watertown, MA); gRNA1: GCGCAGATCACCCAGAAGAT; gRNA2: GGTAAGGCAGATGTCACAGG.

    Transduction:

    Article Title: ISG15 deficiency features a complex cellular phenotype that responds to treatment with itaconate and derivatives
    Article Snippet: From day 3 to 7, cultures were maintained in StemPro‐34 medium (Thermo Fischer Scientific, Massachusetts, USA) supplemented with 260 ng/ml rhVEGF‐A165 and 2 μM Forskolin (Sigma‐Aldrich, St. Louis, USA) with daily medium change. .. CD31+ cells were purified by MACS using CD31 MicroBead Kit (Miltenyi). hiPSC‐ECs were cultured on fibronectin (Corning, New York, USA) coated plates in ECGM‐2 medium (PromoCell, Darmstadt, Germany). hTert‐immortalized dermal fibroblasts from a healthy control and an ISG15‐deficient patient, as well as ISG15 –/– fibroblasts transduced with WT or ΔGG ISG15 were kindly provided by Dusan Bogunovic. .. In HaCaT cells the ISG15 locus was ablated with the CRISPR/Cas9 system using two guide RNAs (gRNA) cloned separately into vector PX458_pSpCas9‐2A‐GFP (Addgene, Watertown, MA); gRNA1: GCGCAGATCACCCAGAAGAT; gRNA2: GGTAAGGCAGATGTCACAGG.



    Similar Products

    96
    PromoCell endothelial cell growth media microvascular 2 ecgm mv2
    Endothelial Cell Growth Media Microvascular 2 Ecgm Mv2, supplied by PromoCell, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ecgm+2+medium/Endothelial+Cell+Growth+Medium+MV+2+Kit/pmc13135260-48-17-23
    Average 96 stars, based on 1 article reviews
    endothelial cell growth media microvascular 2 ecgm mv2 - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    97
    PromoCell promocell ecgm 2 medium
    Promocell Ecgm 2 Medium, supplied by PromoCell, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ecgm+2+medium/Endothelial+Cell+Growth+Medium+2+SupplementPack/pmc12910996-49-3-7
    Average 97 stars, based on 1 article reviews
    promocell ecgm 2 medium - by Bioz Stars, 2026-10
    97/100 stars
      Buy from Supplier

    96
    PromoCell ecgm mv2
    Ecgm Mv2, supplied by PromoCell, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ecgm+2+medium/Endothelial+Cell+Growth+Medium+MV+2+Kit/pmc12808729-36-0-2
    Average 96 stars, based on 1 article reviews
    ecgm mv2 - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    98
    PromoCell 12321d endothelial cell growth medium 2 ecgm 2 promocell
    12321d Endothelial Cell Growth Medium 2 Ecgm 2 Promocell, supplied by PromoCell, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ecgm+2+medium/Endothelial+Cell+Growth+Medium+2/pm41175867-883-128-135
    Average 98 stars, based on 1 article reviews
    12321d endothelial cell growth medium 2 ecgm 2 promocell - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    97
    PromoCell cell growth media 2 ecgm 2
    Cell Growth Media 2 Ecgm 2, supplied by PromoCell, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ecgm+2+medium/Endothelial+Cell+Growth+Medium+2+SupplementPack/pm41175867-900-38-44
    Average 97 stars, based on 1 article reviews
    cell growth media 2 ecgm 2 - by Bioz Stars, 2026-10
    97/100 stars
      Buy from Supplier

    97
    PromoCell ecgm 2 medium
    Ecgm 2 Medium, supplied by PromoCell, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ecgm+2+medium/Endothelial+Cell+Growth+Medium+2+SupplementPack/pm40686480-125-23-25
    Average 97 stars, based on 1 article reviews
    ecgm 2 medium - by Bioz Stars, 2026-10
    97/100 stars
      Buy from Supplier

    90
    Lonza endothelial cell growth medium (ecgm)-2 bulletkit
    Endothelial Cell Growth Medium (Ecgm) 2 Bulletkit, supplied by Lonza, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ecgm+2+medium/egm+2+medium/10__1016_slash_j__rpth__2025__102947-64-13-18
    Average 90 stars, based on 1 article reviews
    endothelial cell growth medium (ecgm)-2 bulletkit - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Lonza ecgm-2 medium
    Ecgm 2 Medium, supplied by Lonza, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ecgm+2+medium/ecgm+2/pmc12052699-58-18-20
    Average 90 stars, based on 1 article reviews
    ecgm-2 medium - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    Image Search Results